circad | circRNAs associated with diseases

hsa_circ_0067531
Gene	PIK3CB	Organism	Human
Genome Locus	chr3:138413627-138417937:-	Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink	Link to database	PMID	29251325
Experimental Method
Sample Type	HCC Tissues	Comparison	eight pairs of Hepatocellular Carcinoma tumor tissues and corresponding non-tumor tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TCCAGACCAGTACGTTCGAG Reverse TCACACAGTTGAGACAAGGGAT	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Zhang, K, Che, S, Su, Z, Zheng, S, Zhang, H, Yang, S, Li, W, Liu, J (2018). CD90 promotes cell migration, viability and sphere��€"�forming ability of hepatocellular carcinoma cells. Int. J. Mol. Med., 41, 2:946-954.